Nov 1—Hepatitis B

 

Experimental Therapies

459. Complementary and Alternative Medicine Use in Children with Chronic Viral Hepatitis

J. Erlichman; B. Haber

 

Objective:

To assess prevalence, rationale and factors associated with use of complementary and alternative medicine (CAM) in pediatric chronic viral hepatitis at a tertiary specialty practice.

 

Methods:

Sixty-three self-administered questionnaires were completed by parent-proxy or child with diagnosis of chronic hepatitis B (55.9%) or hepatitis C (44.1%)virus infection. The questionnaire included 25 questions regarding: socio-demographic information for patient and parent, type of viral hepatitis and medical history, types of CAM used since diagnosis, frequency of CAM use, reasons for CAM use, perceived benefits of use, degree of physician-patient disclosure of use and CAM information sources. Data were entered into SPSS 15.0. Univariate analysis compared demographic and clinical factors between CAM users and non-users. Multiple logistic regression analysis was used to identify independent predictors of CAM use.

 

Results:

Forty-six percent of children tried at least one CAM therapy since diagnosis of viral hepatitis and 31% reported use of CAM on a monthly or more frequent basis. The most common CAM therapies used were: milk thistle (21%), essential fatty acids (14.7%), self-prayer/spiritual healing (13.2%), deep breathing exercises (11.7%), probiotics (8.8%) and massage (8.8%). CAM use was independently associated with: child having either currently or previously received antiviral medicine for viral hepatitis, parent’s use of CAM, and child having a non-liver co-morbidity (e.g. ADHD, asthma). CAM use was not associated with type of viral hepatitis, age at diagnosis, or any socio-demographic variable. Common reasons for choosing CAM were (1) to support the body’s fight against viral hepatitis (2) having heard of benefits claimed for CAM, and (3) a belief that CAM could improve health when used in combination with conventional medicine. Among CAM users sources for CAM information included: friends or colleagues (29%), internet (29%), and books, magazines or newspapers (22.6%), and advice from others (19.4%). Only 32.3% of parents always disclosed their child’s CAM use to the child’s doctor and only 12% of doctors always ask about CAM use.

 

Seventy-five percent of respondents said they spent less than $25.00 a month on CAM for children. 

 

Conclusion:

1.     CAM use is common in children with chronic viral hepatitis. Forty-six percent of children had tried CAM at least once and nearly 1/3 used CAM on a regular basis.

2.     Rate of physician non-disclosure is high. Medical practitioners caring for this patient population must be cognizant of the possible use of CAM and inquire about specific CAM therapy.

 


Diagnostic Tools

460. The Performance of the AST-to-Platelet Ratio Index as a Noninvasive Marker of Fibrosis in Pediatric Patients with Chronic Viral Hepatitis.

K. E. McGoogan; W. F. Berman; R. Jhaveri

 

Background:

AST-to-platelet ratio index (APRI) has been studied in adults as a possible correlate with degree of liver fibrosis on biopsy in patients with chronic hepatitis B or hepatitis C. Studies in children have been limited. The purpose of the study was to investigate whether APRI could serve as a non-invasive marker of fibrosis in children with chronic viral hepatitis.

 

Methods:

All patients 0 – 20 years old with a diagnosis of chronic hepatitis B or C seen at tertiary medical center from 1/1/1992 until 1/1/2008 were evaluated. Patients were identified using: 1) ICD-9 diagnosis code for Hepatitis B or Hepatitis C, 2) a positive result of HCV RNA, HCV antibody test, Hepatitis B surface antigen, or HBV DNA. Dictated pathology reports of liver biopsies from any of these patients were then obtained. APRI was calculated if laboratory data was available within 4 months of liver biopsy. Patients were excluded if they did not have complete data, or were recently status post liver transplant. Receiver operating characteristic (ROC) curves were generated investigating APRI in predicting fibrosis and cirrhosis.

 

Results:

Forty-eight patients with chronic HCV and HBV were evaluated with a mean age of 12.4. 50% of the patients were male, 29% had hepatitis B and 71% had hepatitis C. The mean fibrosis score was 1.6. ROC curves were generated which revealed areas under the curve of 0.60 -0.63 for cirrhosis and significant fibrosis, respectively. The APRI was better at predicting significant fibrosis (METAVIR score >2), than predicting cirrhosis, but was still a very crude marker for fibrosis.

 

Conclusion:

The APRI has limited value in predicting the presence of significant fibrosis in these patients. Further research into this and other potential non-invasive markers of fibrosis in pediatric patients with chronic viral hepatitis is warranted.

 


Diagnostic Tools

515. Analyzing HBV-DNA in Liver Tissue for Investigation of Unexplained ALT Elevation in HBsAg Positive Patients with Undetectable Serum HBV-DNA

C. P. Eyigun; O. Coskun; H. C. Gul; E. Gunal; A. Kubar; I. Y. Avci; H. Erdem; B. A. Besirbellioglu; L. Gorenek

 

Background:

Some patients with positive HBsAg and unexplained elevated ALT have undetectable serum HBV-DNA repetitively. In this study we tried to explain the reason for ALT elevation in such patients and to realize the relation between liver HBV-DNA levels and liver damage.

 

Materials and Methods:

Sixty-three HBsAg positive, serum HBV-DNA negative patients with unexplained elevated ALT levels were enrolled in the study. After an informed consent, they underwent liver biopsy. Modified Knodell’s Index was used for histopathological examination. HBV-DNA was extracted from liver tissue and analyzed with TaqMAN real time PCR using Forward 5’-atcctcacaataccRcagagt-3’ and Reverse 5’-caaatggcactagtaaactgagc-3’ primers and TaqMAN Prop FAM actcgtggtggacttctctcaattttc BHQ-1 as described by Kubar et al.

 

Results:

The average age of the patients was 27±9.37 years. The average of ALT levels was 68.3±28.8 IU/L. Liver HBV-DNA assay in 12 (17.9 %) patients yielded negative result. In histological examination; histopathological activity index for 3 patients was mild (moderate) and for 2; fibrotic stage was 2/6. Liver HBV-DNA assay for 51 (82.1%) patients yielded 2 x 107 ± 4x107 copies/ml. In histological examination; histopathological activity index for 3 patients was severe, for 7; mild (moderate), for 4; fibrotic stage was 3/6 and for 4; 2/6. HBeAg was positive for 9 (17.6%) of 51 cases whose HBV-DNA is positive in their liver tissue. No correlation was observed between either liver HBV-DNA levels with ALT levels (r=+0.1; p>0.05), with histopathological activity index (r=-0.089; p>0.05) or with fibrosis (r=0.072; p>0.05).

 

Conclusion:

Despite new molecular techniques provide rapid and accurate quantification of serum HBV-DNA, undetectable serum HBV-DNA can not satisfy diagnostic and therapeutic criteria due to problems such as fluctuation and cut-off levels. Liver HBV-DNA assay may help to clarify unexplained ALT levels in patients with positive HBsAg, undetectable serum HBV-DNA and consequently prevents delays in therapy.

 


HBV Treatment – Adefovir and Lamivudine Resistance

513. Addition of Adefovir Dipivoxil to Lamivudine in Chronic Hepatitis B Patients with YMDD Mutation: The long-term follow-up results

C. P. Eyigun; H. C. Gul; O. Coskun; E. Gunal; H. Erdem; I. Y. Avci; L. Gorenek; B. A. Besirbellioglu; A. Kubar

 

Background:

Although lamivudine used for chronic hepatitis B is a potent and well-tolerated drug, there is an increasing resistance parallel to its duration of usage. Addition of adefovir dipivoxil to therapy for patients with resistance to lamivudine seems to prevent adefovir resistance. The aim of this study was to asses the effectiveness of adding adefovir dipivoxil to therapy for lamivudine resistant patients, and to define the long-term follow-up results for emergence of adefovir resistance.

 

Materials and Methods:

Ten milligrams of adefovir dipivoxil was added to the therapy of 75 patients with chronic hepatitis B who developed virological and/or biochemical breakthrough under long-term lamivudine therapy. Serum HBV-DNA assay with TaqMAN real time PCR was performed monthly and serum ALT level was monitored monthly till it declines to its normal limits.

 

Results:

The mean age of the patients was 42,6 ± 12,82 years. Thirty nine patients were HBeAg positive at the beginning of the therapy. After a median 118 (24-268) weeks of follow-up, no adefovir resistance emerged. The average duration for HBV DNA loss was 28,3 ± 34,35 weeks and the average duration for ALT normalization was 42 ± 37,16 weeks. At the end of 48 weeks, 46 ( 61 %) patients had HBV DNA loss in the serum, ALT was normalized in 31 (56 %), HBeAg become negative in 8 (20%) and HBeAg-AntiHBe seroconversion was observed in 3 (8%) patients. No patients become HBsAg negative, no serious side effects and hepatic decompensation were observed.

 

Conclusion:

Addition of adefovir to ongoing lamivudine therapy in chronic hepatitis B patients with lamivudine resistance is safe and efficient. It is well-known that switching lamivudine to adefovir dipivoxil in lamivudine resistant chronic hepatitis B patients results in substantial adefovir resistance. So continuation of lamivudine in these patients seems to prevent genotypic resistance to adefovir and clinical breakthrough.

 


Lamivudine Resistance

514. Demonstration of YMDD Mutation in Liver Tissues of 14 Chronic Hepatitis B Patients under Lamivudine Therapy

C. P. Eyigun; E. Gunal; A. Kubar; H. C. Gul; O. Coskun; I. Y. Avci; H. Erdem; L. Gorenek; B. A. Besirbellioglu

 

Background:

The aim of this study is to demonstrate the lamivudine resistance in liver tissue of the patients whose serum ALT levels are elevated but serum HBV-DNA can not be detected under lamivudine therapy

 

Material and Method:

Fourteen patients under lamivudine therapy were included in the study. Ten cases with elevated ALT and negative HBV-DNA, four patients with severe histopathological activity index and fibrosis underwent liver biopsy. HBV-DNA was extracted from liver tissue and analyzed with TaqMAN real time PCR using forward 5’-atcctcacaataccRcagagt-3’ and reverse 5’-caaatggcactagtaaactgagc-3’ primers and TaqMAN Prop FAM actcgtggtggacttctctcaattttc BHQ-1 as described by Kubar et al.

 

Results:

The patients were 22 to 41 years old (median 41.5 years) and their alt levels were 13 to 104 IU/L (median 39.5 IU/L). They were under lamivudine therapy in a range of one to 10 years (median five years). YMDD mutation was shown for all 14 patients in their liver tissue. One patient had rtM204V, four patients had rtL180M, two had rtL180M + rtM204V, four had rtL180M + rtM204I, and three patients had rtL180M + rtM204I + rtM204V substitutions.

 

Conclusion:

Analyzing mutation in liver tissue of the patients with elevated ALT and negative HBV- DNA under lamivudine therapy or patients with severe liver histology might help us demonstrate lamivudine resistance earlier and prevents in delaying therapeutic modification.

 


Lamivudine Resistance

518. Hepatitis B Genotype Distribution and High Frequency of Lamivudine Resistance Mutations in Brazilian HIV/Hepatitis B Virus Co-infected Patients

M. Mendes-Correa; J. R. Pinho; O. M. Leite; L. G. Martins; A. G. Leite; M. H. Silva; R. Sitnik; D. E. Uip

 

Background:

Information on the genotype distribution and frequency of lamivudine (LAM) resistance mutations in HIV-HBV co-infected patients is scarce, especially in Brazil.

 

Methods:

847 HIV positive patients followed at a single institution were tested for HBV infection. All patients were submitted to hepatitis B surface antigen detection with commercial available kits. HBV viral load was determined by using an in house real time PCR using primers that equally amplify HBV genotypes A to H, after HBV DNA extraction from plasma serum collected in PPT tubes using Qiagen kits. HBV genotypes/subgenotypes, antiviral resistance, basal core promoter (BCP) and precore mutations were detected by DNA sequencing. Surface / polymerase overlapping genes were sequenced from a 720 bp PCR fragment covering amino acids 48 to 288 in the polymerase gene while BCP and pre-core regions were sequenced from a 453bp PCR fragment from nucleotide 1672 to 2125 covering known BCP and pre-core mutations.

 

Results:

A total of 34 HBV-HIV-coinfected patients (4.0%) were identified. Plasma specimens with detectable HBV viremia could be obtained from 26 patients and this was the study population that underwent further virological characterization. All but 5 patients had received LAM. Median time on LAM was 48 months. HBV genotype distribution was: A (n=10 – 38.5%), D (n=3 – 11.5%), G (n=2 – 7.6%) and F (n=1 – 3.8%).

 

Among 21 patients who received LAM, 5 were also receiving tenofovir. In these patients, HBV-DNA viremia was negative in the sample submitted to this assay.

 

Among 16 patients who had received LAM alone, LAM resistance mutations were detected in 8 (50%) patients. rtL180M+rtM204V was the most frequent resistance mutation pattern (n= 6). This pattern was found with accompanying mutation rtV173L in 2 individuals. This nucleotide change produces a simultaneous sE164D mutation in the overlapping surface antigen-reading frame. V207I alone was found in one patient, who had never received lamivudine. Only 5 patients (23.8%) out of 21 treated for at least 12 months with LAM presented sustained virological response.

 

Conclusions:

In this group of co-infected patients:1) HBV genotypes A and D predominate;2) HBV genotype G, (previously reported in Brazil in one homosexual men) was found in 7.6% patients; 3) rtV173L/sE164D, a vaccine escape related mutation, was found in two patients; 4) Therapy with LAM was effective in only 23.8% of patients and was associated with different lamivudine resistance mutations, including mutations that alters HBsAg antigenicity.

 


Epidemiology, Transmission, and Prevention Issues – Disease Awareness

523. How Much Do People with Hepatitis B Know About Their Illness? A cross-sectional survey at a tertiary hospital hepatology clinic

W. Li-Ping; L. Wah-Yun; C. Ng; M. Rosmawati

 

Objectives:

Prevalence of chronic Hepatitis B varies widely from 0.01% to 20% through the world. The data from Malaysian Liver Foundation in 1998 shows that the estimated prevalence of HBsAg among Malaysian general population was 4.7%. It has been widely reported that lack of knowledge affect prevention, treatment and healthcare. This study assessed the knowledge/awareness of basic facts of the disease among hepatitis B patients.

 

Methods:

A total of 483 hepatitis B patients attending the hepatology clinic at the University of Malaya Medical Center (UMMC), Kuala Lumpur were interviewed using a semi structured interview guide from March 2007 to April 2008. The interview guide was pilot-tested and revised.

 

Results:

Respondents had a mean age of 46.3 (SD=14.7) years, majority (48.7%) have had at least a secondary education, and the mean duration of diagnosis was 12 years (SD= 8.8) years. Near half of the respondents could not differentiate whether hepatitis B is a viral (37.2%) or bacterial infection (45.0%). Majority were aware that the clinical consequences of hepatitis B infection include inflammation of the liver (81.7%), liver failure (78.6%) and liver cancer (85.3%). Only 59.6% aware of symptoms of liver disease, with jaundice (89.6%), nausea and vomiting (58.2%), and tiredness (53.6%) as most commonly cited symptoms. Knowledge of modes of transmission was adequate with a majority proportion of correct responses above 70th percentile. The most common modes of transmission mentioned were blood transfusion (90.7%), causal contact (87.8%), mother-to-child transmission (83.9%), and sexual intercourse (79.3%). Forty-five and 5/10 percent (45.5%) have misperception that sharing utensils can transmit the hepatitis B virus.

 

Conclusion:

Despite the relatively high education level among participants in this study, there are still gaps in knowledge among the hepatitis B patients, especially in terms of symptoms of liver disease.  Misconception about the mode of transmission still exist and this could potentially lead to unnecessary social isolation and negative impact on quality of life.

 

The results also suggest that more attention is needed at providing health education on hepatitis B to young patients and those above the age of 60 years old, patients of lower educational level, in newly diagnosed hepatitis B and cirrhotic patients.

 


Disease Progression

317. Role of Viral and Clinical Factors Predicting the Outcomes of Patients with Hepatitis B Virus-Related Acute Liver Failure

D. Y. Dao; H. Yuan; C. Sanders; N. Attar; L. S. Hynan; M. K. Jain; R. Word; W. M. Lee

 

Background:

Acute hepatitis B-related liver failure (HBV-ALF) was observed in the 1970’s to sometimes be associated with undetectable viral loads (VLs) by dot blot hybridization assays (LLD approximately 100,000 IU/mL), a situation that differs markedly from chronic hepatitis B infection. Factors that predict prognosis in HBV-ALF remain to be studied and whether treatment impacts this already-severe condition is controversial. Aims: We studied initial VLs as well as change in VL over time in HBV-ALF and whether VL might predict outcome of HBV-ALF. We also evaluated the possible role of genotypes, HBeAg negative (e-neg) mutations and nucleos(t)ide (NA) treatment.

 

Design/Methods:

Data were collected prospectively on 92 HBV-ALF patients (all HBsAg and anti-HBc IgM pos) between 1998-2007 by the US Acute Liver Study Group; 65 patients had admission sera available and 38 had multiple sera, including at least one at ≥ 48 hrs later, but before transplant. A treatment-naïve chronic HBV group (n=20) served as controls. Real time polymerase chain reaction (LLD ≥ 25IU/mL, 100% sensitivity and specificity) was used to quantify VL. HBV genotypes and e-neg mutations were analyzed by direct sequencing on HBV surface and pre-core regions for 65 samples (26 had been done in a previous study). Statistical analysis was performed using SPSS 15.0. Outcomes were death, spontaneous survival (SS), or transplantation (OLTx) within 3 weeks after admission to study.

 

Results:

Admission VLs of HBV-ALF [median (range): 3.94 log10 (<1.4-8.70) IU/ml] were much lower than chronic HBV [9.35 log10 (2.03-10.02) IU/ml, p<0.001]. However, the 16 patients who died tended to have higher first admission VLs [median (range): 5.13 log10 (<1.40-8.70) IU/mL,] than the 18 in the SS group [4.05 log10 (<1.40-6.90), p=0.055], and significantly higher than the 31 OLT patients [3.74 log10 (<1.4-7.10) IU/mL, p=0.018]. In addition, VL decreased more dramatically over time in the group that died (n=11, p=.033) but not in the OLTx (n=14, 2 died post-op, p=.12) or SS groups (n=13, p=.31). There was no difference between the NA (n=30) and non-NA (n=23) treatment groups, either in initial VLs or decline over time (P=NS). Neither genotype nor the presence of e-neg mutations affected outcome although genotypes B and D had higher VLs at study entry. By logistic regression analysis, only initial VL was an independent predictor of poor outcome-death (p<0.05).

 

Conclusion:

Remarkably low VLs are found in most HBV-ALF patients. Among these patients, a higher VL at admission and rapid VL decline was associated with a poorer outcome. Over the short time interval of the study, NA did not appear to affect VL or outcome.

 


Liver Transplantation

586. Liver Transplantation Trends and Survival in the Asian Population

N. Kemmer; V. C. Zacharias; T. E. Kaiser; G. W. Neff

 

Studies to address ethnic minorities in liver transplantation (LT) have traditionally focused on African Americans and Hispanics. Although, the Asian population accounts for 4.4% of the US population, there is limited information on transplantation trends for this ethnic group. The Aim of this study is to evaluate the transplantation trends and determine survival patterns of Asian LT recipients.

 

Method:

Using the UNOS database, we identified all adult LT recipients (age > 18 yrs) between 1998 and 2007. The data collected included demographics, diagnosis, survival data and UNOS region. Statistical analysis was done using Kaplan-Meier (KM) and log-Rank tests for survival analysis. Results: During the study period, 1953 patients received LT, accounting for 4.1% of all adult LT. Of these, there were 1286 (65.8%) males with a median age of 55 (range 18 – 75). The underlying liver disease was hepatitis B (28.1%), Hepatitis C (18.4%), HCC (17.9%), AHN (11.3%), Idiopathic (3.7%), Alcohol (3.3%), PBC/PSC (3.0%), and others (14.3%). A significant regional variation was observed ranging from 2.6% in Region 10 to 39.6% in Region 5. Additionally there was a significant difference for patient and graft survival between Asian and non-Asian group (see Table I, p<0.001)

 

Conclusion:

(1) Regional variation and differences in liver disease pattern was seen among Asian population with HBV-HCC being the most common. (2) Overall LT recipients of Asian ethnicity have a significant survival advantage especially at (5yr) in comparison to non-Asian groups.

Year

Asian

AA

Hispanic

Caucasian

PATIENT  

1

89%

84%

88%

87%

3

81%

72%

80%

79%

5

76%

65%

74%

73%

GRAFT  

1

84%

79%

83%

83%

3

76%

65%

75%

74%

5

71%

57%

68%

67%

 


Liver Transplantation

594 HBV Recurrence Rate Post-Liver Transplantation (OLT) and Associated Factors: Results of the NIH-HBV-OLT Study

A. F. Lok; S. B. Han; E. R. Schiff; R. S. Brown; S. Emre; C. Soldevila-Pico; K. Reddy; M. Ishitani; E. B. Keeffe; V. A. Luketic; B. Degertekin

 

Background and Aims:

Prophylaxis with antiviral therapy and hepatitis B immune globulin (HBIG) have decreased but not eliminated HBV recurrence post-OLT. We determined the HBV recurrence rate in a cohort of patients prospectively followed in the NIH HBV-OLT study and the impact of antiviral breakthrough pre-OLT and HBIG regimens post-OLT on HBV recurrence rate.

 

Methods:

Data from the NIH HBV-OLT database were analyzed. HBV recurrence defined as detection of HBsAg >1 month after OLT was estimated by Kaplan-Meier and factors associated with HBV recurrence were analyzed by Cox regression.

 

Results:

191 patients (76% men, mean age 52 years, 41% Caucasian, 44% Asian) from 15 centers transplanted for HBV between 3/01 and 9/07 were followed for a median of 41 months (0-81) post-OLT. 51% were transplanted for HCC, 40% for end-stage cirrhosis, and 9% for acute liver failure. At transplant, 29% were HBeAg+, 65% had detectable HBV DNA; 74% patients were receiving antiviral therapy and 14% had experienced breakthrough prior to OLT. All but 6 patients received antiviral + HBIG post-OLT, 2 received HBIG only and 4 antiviral only. HBIG regimens varied across the centers: 26% of patients received IV high dose, 22% IV low dose, 40% IV followed by IM doses and 12% discontinued HBIG after a median of 12 months (1-48). 13 (6.8%) patients had HBV recurrence. Cumulative 1, 3 and 5 year HBV recurrence rates were 3%, 7% and 9%, respectively. None of 46 women and none of 17 patients transplanted for acute liver failure had HBV recurrence. Multivariate analysis found that HBeAg positive at listing (p=0.018), HBV DNA >5 log10 c/mL at transplant (p=0.067), and Caucasian race (p=0.045) were associated with HBV recurrence post-OLT. Neither antiviral breakthrough pre-OLT nor HBIG regimen was associated with HBV recurrence. At the time of HBV recurrence, 5 had lamivudine resistance (LAM-r), 3 had LAM+HBIG-r, 1 had HBIG-r, 1 had wild-type sequence, 2 had undetectable HBV DNA and 1 did not have available sample. Cumulative 1, 3 and 5 year post-OLT survival rates for patients with vs. those without HBV recurrence were 100%, 85% and 76% vs. 93%, 91% and 90%, respectively (p=0.058).

 

Conclusion:

In this U.S. cohort of patients transplanted for HBV, cumulative 5-year HBV recurrence rate was 9%. Most cases (90%) of HBV recurrence were related to antiviral and/or HBIG resistance. Our data suggest that close monitoring for antiviral resistance pre-OLT, prompt initiation of rescue therapy, and use of antiviral drugs with higher genetic barrier to resistance might decrease HBV recurrence rates further. HBIG regimen may be of secondary importance in the era of potent antiviral therapies.

 


Liver Transplantation

597. Total and Covalently Cosed Circular DNA (cccDNA) Detection in Post-transplant Liver Biopsies of HBV-positive Patients Who Underwent Liver Transplantation with Undetectable Viremia

I. Lenci; G. Tisone; D. Di Paolo; L. Tariciotti; M. Ciotti; F. Marcuccilli; T. Guenci; C. F. Perno; M. Angelico

 

Background:

The recommended life-long prophylaxis in patients transplanted due to HBV-related cirrhosis is extremely costly and there are no current criteria to assess whether can be withdrawn. The risk of HBV reactivation is due to persistence of the viral genome in the form of covalently closed circular (ccc) DNA in the infected hepatocytes. Yet, whether cccDNA persists after years of continuous prophylaxis in the liver of HBsAg negative transplant recipients is currently unknown.

 

Patients and Methods:

Total and cccDNA were detected using a nested- and real-time PCR, respectively, with improved analytic specificity and significantly reduced false positives. The tests were performed firstly in liver biopsies obtained from 44 liver transplanted patients (33 M/F; mean age 55.2±8.9 yrs) due to HBV-related cirrhosis, 19 of whom maintained on i.v HBIG alone since time of transplant and 25 patients HBIG in combination with lamivudine 100 mg/day. The mean follow-up after transplant was 88.3 months (range=13-159). Out of 44 patients, 30 underwent HBIG withdrawal and were observed for a period of 6 months, monitoring HBsAg and HBVDNA quarterly. The remaining 14 patients were excluded from the study because of HBV recurrence after transplant (n=1), poor compliance (n=7) and unwillingness to undergo further liver biopsies (n=6). After a mean of 25 weeks (range=24-26) of HBIG withdrawal, a second biopsy and a new detection of liver total and cccDNA were performed. Based on these results, 13 patients underwent lamivudine withdrawal, maintaining the only immunosuppressive therapy. The mean follow-up after lamivudine withdrawal was 15.8 weeks (range=5-22). HBsAb and HBVDNA were checked monthly during this period. Maintenance of immunosuppression included in the majority of patients Cyclosporine A, tacrolimus or mycophenolate monotherapy.

 

Results:

Among the initial cohort of patients screened for total and cccDNA, 1 had HBV recurrence after transplant and detection of total and cccDNA was positive. In the other 43 liver biopsies total and cccDNA resulted negative. Among the 30 patients who underwent HBIG withdrawal, 29 resulted total and cccDNA negative. Only 1 patient was found to be total and cccDNA positive.

 

Conclusions:

In this cohort of transplant recipients at low risk of HBV recurrence who received the recommended HBV prophylaxis for a minimum of 5 years and who did not exhibit viral breakthrough after transplant no evidence of intrahepatic cccDNA was found in the liver. These patients are unlikely to undergo HBV recurrence and, if data will be confirmed in more extensive follow-up, could be cautiously considered for complete prophylaxis withdrawal.

 

 


Liver Transplantation

598. Prevention of Recurrent Hepatitis B Virus Infection after Liver Transplantation: HBIg, Anti-viral Drugs, or Both? Systematic Review and Meta-analysis

L. Katz; M. Paul; D. Guy; L. Leibovici; R. Tur-Kaspa

 

Background:

Recurrence of hepatitis B virus (HBV) infection is a major problem for patients undergoing liver transplantation for HBV cirrhosis. The use of post transplantation hepatitis B immuneglobulins (HBIg), antiviral drugs or a combination of both decrease recurrence rates.

 

Method:

We conducted a systematic review and meta-analysis in order to evaluate these three strategies.

 

The Cochrane Central Register of Controlled Trials, MEDLINE, LILACS, and EMBASE were searched until December 2007. Clinical trials and comparative cohort studies, comparing the use of HBIg, anti virals or both following liver transplantation for HBV infection were included. The outcomes assessed were: all cause and HBV-related mortality; HBV related active liver disease; and reappearance of hepatitis B surface antigen (HBsAg) or HBV DNA after transplantation. Relative risks (RR) with 95% confidence intervals are reported.

 

A total of 19 studies (21 comparisons) were included. Three were randomized controlled trials (RCT); two prospective studies with historical controls; and 14 retrospective studies. Three studies, 133 patients, (two RCT) compared lamivudine to HBIg; 10 studies, 651 patients, compared HBIg alone to combination treatment; and 8 studies, 649 patients,(one RCT) compared lamivudine to combination treatment. There was no significant difference between HBIg and lamivudine when given alone, in all measured outcomes. Combination treatment was superior to HBIg alone in all outcome measures: it reduced overall mortality (RR 0.44 0.25-0.77), HBV-related mortality (RR 0.12, 0.05-0.30), HBV-related active liver disease (RR 0.16, 0.07-0.37) and HBV recurrence (RR 0.28, 0.12-0.66 for HBsAg re-appearance and RR 0.21, 0.04-0.98 for HBV DNA re-appearance).

 

Conclusion:

1.     Combination treatment was significantly better than lamivudine alone only in preventing HBsAg re-appearance (RR 0.30, 0.21-0.43). There was a tendency favoring combination treatment for HBV related mortality (0.31, 0.09-1.10) and active liver disease (0.40, 0.15-1.02).

 

2.     Combination treatment with HBIg and lamivudine reduces overall mortality with a number needed to treat of 6 patients compared to HBIg alone and prevents more cases of HBV recurrence after liver transplantation.

 

3.     Combination treatment can include low-dose HBIg.

 

4.     When compared to lamivudine alone it prevents HBsAg re-appearance more efficiently. Results are based mainly on non-randomized studies.

 


Liver Transplantation

599 Tenofovir Is Effective in Suppressing HBV Replication in Liver Transplant Recipients with Nucleos(t)ide Resistant Recurrent Disease

L. Lilly; G. Therapondos; A. L. Mason; K. W. Burak

 

Background:

Liver disease and hepatoma due to hepatitis B (HBV) remain important indications for liver transplantation (LT). Results have improved dramatically in the past decade with the widespread use of nucleoside therapy in combination with HBIG following LT to prevent graft reinfection. However, breakthrough due to genotypic resistance occurs in approximately 5% of cases, requiring the addition or substitution of newer antiviral agents. Tenofovir disoproxil (TNF) has been shown to be effective in controlling HBV in wild-type and lamivudine-resistant (LAM-R) disease; however, its role in nucleos(t)ide resistant HBV in LT recipients has not been well defined.

 

Aims:

To examine the outcomes of LT recipients with drug-resistant recurrent HBV treated with TNF. Methods: Data was collected from two large Canadian LT centers, the University of Alberta (Edmonton and Calgary clinics), and the University of Toronto. We included patients who underwent LT for HBV, without drug-resistant disease at the time of transplant, who went on to develop lamivudine resistance after LT. One patient who received a core-positive donor when transplanted for a non-HBV indication (PSC) has been included, but patients with de novo HBV infection post LT were excluded. Patient survival, liver biochemistry, and HBVDNA levels were determined.

 

Results:

Fifteen patients were identified. Mean age at transplant was 52y (31-68) and all were male. HBeAg/eAb information was available in 12 patients pre-LT, and 10 were eAb (+). Eight patients were on LAM at the time of LT; one other had been treated in the past. Ten patients had serum HBVDNA measured within 3m of LT and 6 had detectable levels. After LT, fourteen patients either continued or were started immediately on LAM; the other started on LAM 32m post LT. Eleven patients also received HBIG for 4-30m according to center protocols. LAM-R developed at a mean of 27m (1-66). Ten patients immediately received TNF. Three others were switched to TNF after entecavir was ineffective. Two had TNF introduced after they developed resistance or renal toxicity while on adefovir. Serum HBVDNA at time of TNF ranged up to >2000pg/mL or >1x10E9 copies/mL. Mean follow-up is 26m (8-72m). Serum HBVDNA has fallen dramatically in all; 12 have undetectable levels, attained after a mean of 10m of TNF. All patients are alive with normal graft function and normal or improving normal biochemistry. One patient required TNF dose reduction for renal insufficiency. To date, no TNF resistance has developed.

 

Conclusions:

·        TNF is effective and well tolerated in drug-resistant HBV in LT recipients.

·        In all of the patients there was a dramatic decline in HBV DNA following introduction of tenofovir and the majority are DNA negative at least on follow-up.  However, 2 patients woth with a history of ETV as well as LAM resistance, continue to be HBV DNA positive , albeit, with low titers which at last determination are not increasing.  Thus no true cases of tenofovir resistance have occurred in this population. 


Liver Transplantation

600. Liver Transplant Recipients with Evidence of Past Hepatitis B Infection are Not at Increased Risk for De Novo Hepatitis B

H. K. Niho; D. J. Quan; J. P. Roberts; F. Yao; N. Terrault; M. G. Peters

 

Background:

Hepatitis B may reactivate after immunosuppresssion even in those who have lost HBsAg. Vaccination of recipients is critical to protect against de novo HBV but is less effective in patients with end stage liver disease. De novo hepatitis B has been described among recipients of liver transplants from donors with evidence of past HBV infection, including donors with anti-HBc alone. While the majority of HBV replication occurs in the liver, extra-hepatic replication can occur. Whether these sites are a source of cccDNA is unclear.

 

Aim:

To investigate whether liver transplant recipients with serologic evidence of past HBV infection (anti-HBc ± anti-HBs positive) are at risk for de novo HBV after liver transplantation (OLT).

 

Methods:

Medical records of all patients undergoing OLT at UCSF from 2/1/1988 through 12/31/2006 were retrospectively reviewed. No donor organs were obtained from executed prisoners or other institutionalized persons. Based on their serologic profile pre-transplant, patients were divided into three groups: 1) past HBV (HBsAg neg, anti-HBs pos, anti-HBc pos), 2) anti-HBc+ alone, and 3) no serologic evidence of HBV infection. Patients who were transplanted for hepatitis B and those with evidence of previous vaccination were excluded. Patients were followed for the development of de novo HBV defined as the appearance of detectable HBsAg.

 

Results:

During the study period, 2,005 patients underwent liver transplantation, and 583 were excluded because they were transplanted for HBV or had evidence of previous vaccination. The study cohort included 206 patients in Group 1, 240 in Group 2, and 976 in Group 3. The median follow up was 54 months with a range of 0-242. There was no difference between groups in age at OLT or ethnicity. Markers of past HBV were more common in males 72% (Groups 1&2) versus 52% (Group 3) and those with HCV infection 48-52% (Groups 1&2) versus 22.5% (Group 3). De novo HBV occurred in 1% of groups 1 and 2 and 1.8% of group 3 (ns). When donor HBV status was evaluated, de novo HBV occurred in 11.5% of recipients of anti-HBc positive donors, only one of whom was on nucloes(t)ide prophylaxis at the time. Overall, 77% of transplant patients who received anti-HBc positive donors received prophylaxis with nucleos(t)ide analogues. De novo HBV developed in 0.5% of those receiving HBV negative livers.

 

Conclusions:

De novo HBV is not increased in liver transplant recipients with evidence of past HBV infection unless they receive organs that are anti-HBc positive. There may be no or insufficient cccDNA in extrahepatic stores, and thus reactivation of HBV under immune suppression rarely occurs.

 

 


Liver Transplantation

605. Use of Grafts from HBsAg-negative HbcAb-Positive Donors in Liver Transplantation: Long-term Results of a Selective Assignation Strategy

M. Prieto; A. Rubin; M. Berenguer; V. Aguilera; S. Benlloch; C. Ortiz

 

Background:

Different strategies have been developed to minimize the risk of hepatitis B in recipients of livers from HBcAb+ donors but their long-term efficacy is largely unknown.

 

Aim:

To report the long-term results with the use of grafts from HBcAb+ donors using a selective assignation protocol.

 

Methods:

HBcAb+ grafts were used whenever possible in HBsAb+ and/or HBcAb+ recipients or in hepatitis B recipients (matched group). In this group, only hepatitis B recipients received HBV prophylaxis (HBIG plus lamivudine). If no appropriate recipients existed on the waiting list, HBcAb+ livers were used in naïve HBsAb- HBcAb- patients (unmatched group) and prophylaxis with im HBIG (2.000 U /monthly before july 2001) or lamivudine (after july 2001) was administered.

 

Results:

From 1999 to 2006, 124 (14.7%) out of 844 patients received a HBcAb+ graft at our center. The study population consisted of 103 recipients with at least 3 months of HBV follow-up (median 3.6 years, range: 0.2-8 years). Overall, 12 (11.6%) recipients developed hepatitis B, defined as detection of HBsAg on at least 2 occasions, at a median time of 18,5 months (range: 3-77) following OLT. In the matched group (n=57), only 1 (6.7%) of the 15 hepatitis B recipients developed HBV infection. In the 42 anti-HBs+ and/or anti-HBc+ recipients, the risk of hepatitis B differed according to their HBV serological profile at the time of OLT (table 1).

 

In the unmatched group (n=46), 38 naïve patients received HBV prophylaxis and 8 did not. Hepatitis B developed in 4 (50%) out of 8 naïve recipients not receiving any prophylaxis and in 3 (8%) out of 38 who received it (p=0.01). In the latter group, only 1 (3.7%) of the 27 patients who received lamivudine alone developed hepatitis B vs 2 (25%) out of 8 who received HBIG as initial prophylaxis (p=0.12). 5-year patient survival was 56% in patients who developed hepatitis B vs 74% in those who did not(p=ns). Only one death was due to HBV-related liver failure.

 

Conclusions:

A selective assignation strategy in which HBcAb positive grafts are first used in HBsAb+ and/or HBcAb+ patients or in HBV recipients is safe in the long-term. Different risk groups, however, can be identified according to the recipient’s pre-OLT HBV serological profile. Lamivudine alone is very effective in reducing the risk of hepatitis B in naïve recipients and its efficacy appears to be superior to that of HBIG alone.

 

Table 1:

pre-OLT HBV markers

n

hepatitis B (n, %)

HBsAb+ alone

4

0 (0%)

HBsAb+ HBcAb+

22

1 (4.5%)

HBcAb+ alone

16

3 (18.8%)

 


Liver Transplantation

611. Prevalence of Hepatitis B Virus (HBV) in Explanted liver and Peripheral Blood Mononuclear Cells (PBMC) in Patients on Effective Antiviral Therapy undergoing Liver Transplantation (LT) for HBV

C. S. Coffin; P. M. Mulrooney-Cousins; M. G. Peters; J. P. Roberts; T. I. Michalak; N. Terrault

 

Background:

Despite effective prophylaxis, recurrent serologically evident HBV infection occurs, albeit infrequently. Elevated serum HBV DNA (>10^4 IU/ml) at LT is the primary factor linked with recurrence but whether HBV status in liver and PBMC is a better predictor of recurrence and might allow refinement of prophylaxis regimens is unknown.

 

Aim:

We determined HBV status in liver, PBMC and plasma at LT in patients with HBV DNA undetectable in serum. Methods: Explant liver (N=9), PBMC (N=6) & plasma (N=7) were collected from 9 patients. No prisoners or institutionalized persons donors used. HBV DNA was determined by PCR/nucleic acid hybridization (PCR/NAH; sensitivity ~2 IU/ml) using primers specific for 4 HBV genes (C=core, P=polymerase, S=surface & X). Liver & PBMC found HBV DNA reactive were tested for HBV covalently closed circular DNA (cccDNA) by PCR/NAH (sensitivity ~20-50 IU/g total DNA).

 

Results:

At the time of LT, all were receiving antiviral therapy; 4/9 treated for lamivudine (LAM) resistant HBV (1 with concurrent adefovir, ADV, resistance). All 9 explants were positive for HBV DNA & HBV cccDNA, 3/4 with levels >200-500 IU/g total DNA were from patients with history of drug resistance. Further, 3/6 PBMC were positive for HBV DNA & 1 was cccDNA positive, while 2/7 plasma tested had HBV DNA levels <20 IU/ml. At 1 year post-LT, there were no recurrences, HBV DNA undetected (UD) in serum by Roche TaqMan PCR (<50 IU/ml) or ViraCorTM qPCR (<29 copies/ml) & all were receiving combination hepatitis B immune globulin/oral antivirals. Conclusion: Despite HBV suppression in serum, HBV DNA & cccDNA was detected in liver, and viral DNA was detected in PBMC & plasma in ~1/3 of patients. Patients with persistent HBV in extrahepatic compartments or with high intrahepatic levels of HBV may be at risk for recurrence & conversely, absence of HBV DNA may identify those in whom prophylaxis can be minimized. Although serum HBV DNA is used as the main predictor of HBV recurrence post-LT, evaluation of viral reservoirs may be more important in the current era of highly effective antiviral therapy.

 

Age/Sex
Drug Resistance

Pre-LT HBV DNA & cccDNA by PCR/NAH

Plasma
IU/ml

Explant
DNA
IU/μg

Explant cccDNA
IU/μg

PBMC
DNA
IU/μg

PBMC cccDNA
IU/μg

59 M
LAM-R

UD*

C S X
>200

<200

NA

NA

66 M
LAM-R

UD

C S X
>200

<20

NA

NA

50 M
LAM-R
ADV-R

3540*

C S X
>200

<20

NA

NA

50 M

UD

C S X
20-200

<20

X
<20

NA

60 M

C
<20

C S X
20-200

<20

UD

NA

67 M

UD

C S X
20-200

<20

C S
<20

<20

63 F

C X
<20

C S P X
>200

<200

C S P
<20

UD

55 M

UD

C S X
20-200

<200

UD

NA

38 M
LAM-R

UD

C S
20-200

<20

UD

NA

*clinical test ~6 mo pre-LT

 


Liver Transplantation

612. Oral Antiviral Therapy Without Hepatitis B Immunoglobulin to Prevent De Novo Hepatitis B in Hepatitis B Core Antibody Positive Liver Transplant Recipients

R. Potru; S. M. Cohen; S. F. Dodson; J. Ahn

 

Background:

Up to 50% of patients receiving hepatitis B core antibody (HBcAb) positive donor livers may acquire de novo hepatitis B (HBV) infection after liver transplant (LT) in the absence of prophylactic therapy. Hepatitis B immunoglobulin (HBIG) reduced incidence to 0-20%, but is costly and inconvenient to administer. Small studies have suggested that nucleos(t)ide analogue therapy (NAT) with lamivudine (LAM) may be even more effective than HBIG. This abstract presents the largest study to date using NAT without HBIG in prevention of de novo HBV in HBcAb + graft recipients. Furthermore, it is the first to examine the use of NAT combination therapy using adefovir (ADV) with LAM as prophylaxis.

 

Methods:

All patients undergoing LT at our center from HBcAb + donors from 2002 and 2008 were identified retrospectively. Our center did not utilize any HBIG in HBcAb + liver graft recipients during the study period. Recipients with HBV and those who did not receive NAT were excluded from the study. Patient demographics, medication regimen, and adverse events were noted. The primary endpoint was de novo HBV as defined by a positive HBV DNA.

 

Results:

Thirty-six patients were identified. 29/36 (81%) were placed on LAM. 7/36 (19%) were placed on LAM and ADV. There were no significant NAT associated adverse events. Mean follow up was 669 days. 4/36 (11.1%) patients developed de novo HBV at a mean 710 (range 340-986) days post-LT. All 4 had been treated with LAM monotherapy. There was no statistically significant difference between patients on LAM compared to patients on LAM + ADV with respect to the development of de novo HBV. (p= 0.56) None of the de novo HBV patients developed significant hepatic sequelae, and all became HBV DNA negative following the addition of ADV. Overall patient survival at 1 and 3 years was 92% and 75%, respectively. 1 and 3 year patient survival in patients receiving LAM was 91% and 71%. In patients receiving LAM + ADV, 1 and 3 year survival rates were both 100%. Overall, 3/36 (8.3%) of the patients required re-LT unrelated to de novo hepatitis B at a mean 568 days. 6/36 (16.7%) patients died due to stroke, sepsis, and other causes unrelated to de novo HBV.

 

Conclusions:

NAT without HBIG was safe and effective in preventing post-LT de novo HBV in this study. Although LAM +ADV combination therapy showed a numerical trend toward superiority over LAM monotherapy, sample size limited the ability to demonstrate a statistically significant difference. Based on these results, NAT should be used to prevent HBV after LT in HBcAb+ patients. In addition, further study of combination LAM and ADV without HBIG appears justified.

 


Liver Transplantation

621. Excellent 5-year Overall Survival in Patients with HBV-related Cirrhosis Undergoing Liver Transplantation for Hepatocellular Carcinoma

P. Lampertico; M. Viganò; S. Bhoori; F. Agnelli; M. Donato; M. Bongini; M. Iavarone; C. Cotsoglou; A. Russo; L. Caccamo; G. Rossi; M. Colombo; V. Mazzaferro

 

Background and Aim:

The long-term outcome of hepatitis B virus (HBV) infected patients who underwent liver transplantation (LT) because of hepatocellular carcinoma (HCC) and received nucleos(t)ide suppressive therapy, is unknown. Patients and Methods: We retrospectively reviewed all patients consecutively transplanted between January 1999 and September 2007 for HCC in HBV-related cirrhosis in two Italian LT Centers. Before LT, all patients underwent anti-HBV therapy and bridge treatment with radiofrequency and/or chemoembolization. Post-LT prophylaxis was LMV+HBIg in 49 (63%) patients, LMV+ADV+HBIg in 25 (32%) and HBIg in 4 (5%). Endpoints of the study were overall survival and HBV- and HCC-recurrence rates.

 

Results:

Seventy-eight patients were followed-up for a median of 48 (2-110) months. Five patients (6%) showed HCC recurrence after a median of 15 month (3-39) while 4 patients (5%) had HBV recurrence at month 1, 3, 18, 38. Six patients (7%) died: causes of death were recurrent HCC (=2), infection (n=2), de-novo neoplasia (n=1), surgical complications (n=1). The estimated 5-yr cumulative rates of HCC and HBV recurrence, and survival were 9%, 7% and 91%. HCC recurred in 3 of 69 patients fulfilling the Milan criteria compared to 2 of 9 exceeding Milan criteria (5-year recurrence: 5% vs 35%, p<0.01). HBV recurred in 4 of 6 patients with pre-LT HBV DNA > 5 log cp/ml compared to none of the 72 with < 5 log viremia (67% vs 0%, p<0.001). The 4 recurrent patients had LMV resistance; 2 developed high HBV DNA levels and HBeAg positive chronic hepatitis, one had a fibrosing cholestatic hepatitis, one maintained undetectable HBV DNA.

 

Conclusions:

Cirrhotic patients undergoing liver transplantation for HBV-related HCC within the Milan criteria and under anti-HBV therapy had excellent overall 5-year survival with negligible rates of HCC and HBV recurrence.

 


Liver Transplantation

622. One-Year Extended Anti-HBV Vaccination with an MPL-Adjuvanted Vaccine Combined with Anti-HBs Immunoglobulins in Patients Liver Transplanted for HBV-Related Cirrhosis

M. Angelico; D. Di Paolo; I. Lenci; L. Tariciotti; A. Monaco; F. Marcuccill2; C. Perno; G. Tisone

 

Background:

Post-transplant active immunization with HBsAg vaccine is a potential prophylaxis strategy against HBV-recurrence after liver tranplantation due to HBV-related disease. Previous studies showed conflicting results using standard vaccines, whereas the use of the new adjuvant 3-deacylated monophosphoryl-lipid-A (MPL) significantly increased patient’s immunization rate through an high anti-HBs titre increase. Aim: We investigated the efficacy of a long-term (12 months) and accelerated (monthly doses) vaccination schedule using the MPL-adjuvanted recombinant S vaccine administered with and without concomitant HBIg.

 

Methods:

Eighteen patients (M/F:13/5) transplanted for HBV-related cirrhosis 73±38 months earlier were recruited. All were HBsAg and HBV DNA negative in serum and cccDNA negative in liver tissue; 5 (27.7%) were co-infected with HCV and 5 (27.7%) with HDV. Study protocol consisted of 12 consecutive monthly intramuscular vaccine doses (HBsAg 20mg plus MPL 50mg) given together with lamivudine (100 mg/daily). Each of the initial 6 doses (first protocol phase) was administered within 7 days after 2000 IU HBIg i.v. infusion, while the last 6 doses were given after complete HBIg withdrawal (second protocol phase). HBsAb titre was determined before each vaccine dose and during the follow-up. All patients were maintaiened on low-level immuno-suppression.

 

Results:

All patients completed the whole vaccination program, receiving 12 adjuvanted vaccine doses (first and second protocol phase) and were monitored during 6 months follow-up after vaccination end (third protocol phase). No side effects occurred, nor evidence of HBV recurrence. At the end of first phase 18/18 (100%) patients achieved an anti-HBs titre greater than 100 IU/L (mean 393±391 IU/L) and 3 (16.6%) a titre greater than 500 IU/L. At the end of follow-up 9/18 (50%) and 2/18 (11,1%) had an anti-HBs titre greater than 100 (mean 851±599 UI/L) and 500 IU/L, respectively.

 

Conclusions:

Twelve months after HBIg withdrawal and 6 months after last vaccine dose half of the patients reached and maintained a presumably protective anti-HBs titre (>100 IU/L). This intensive schedule using the MPL-adjuvanted recombinant S vaccine, given in combination with HBIG and lamivudine, seems to be more effective than previous HBV vaccination protocols with standard alum-adjuvanted vaccine. Data on the long-term maintenance of a protective anti-HBs titre and confirmation of these results in a larger number of patients are urgently needed before incorporating this prophylactic strategy in the management of transplant recipients with previous HBV-related diseases.

 


Liver Transplantation

625. Low-Dose Hepatitis B Immunoglobulin With Lamivudine For Post-Transplantation Hepatitis B Virus Reactivation And Monthly Hepatitis B Vaccine Application Is Reliable, Cost-effective Treatment Strategies

A. Takaki; T. Yagi; Y. Iwasaki; H. Sadamori; Y. Umeda; S. Shinoura; H. Matsuda; T. Yasunaka; Y. Miyake; H. Kobashi; N. Tanaka; K. Yamamoto

 

Background:

Combination therapy with hepatitis B immunoglobulin (HBIg) and lamivudine has become accepted as the best way to control hepatitis B after liver transplantation. However, the HBIg dose and the target HBs antibody titer have not been determined. Recently, hepatitis B virus vaccine is also applied for post transplantation hepatitis B prevention. Herein, we report our experience using low-dose HBIg combined with lamivudine for hepatitis B and subsequently application of monthly hepatitis B vaccine.

 

Methods:

The study included 27 end-stage hepatitis B virus related liver failure patients who received living donor liver transplantation (LDLT) and survived longer than 6 months; 5 with acute liver failure and 22 with liver cirrhosis. Six months after LDLT, HBIg was administered if the patient’s HBsAb titer was <10 IU/l. Lamivudine was administered to 2/5 of acute liver failure patients and of all cases with liver cirrhosis. Hepatitis B virus vaccine was administered to all patients with acute liver failure longer than one year after LDLT. Six of 22 patients with liver cirrhosis type B received vaccine longer than one and a half year after LDLT.

 

Results:

All of the five acute liver failure patients showed HBs antibody (Ab) positive after 3 to 5 times inoculation of vaccine. Of the liver cirrhosis patients, 2 patients had transient HBsAg recurrence, but reintroduction of HBIg restored their HBsAg-negative status. Of the 6 patients who received vaccine, 2 turned HBs Ab positive after 7 and 9 months of monthly vaccine administration.

 

Conclusion:

Low-dose HBIG with lamivudine reliably and cost-effectively controlled hepatitis B virus reactivation after LDLT. Hepatitis B virus vaccine was 100% effective in acute liver failure patients that should be administered. Hepatitis B vaccine was effective in only selected patients with liver cirrhosis but should be tried since vaccine effective or non-effective patients could not be predicted.

 


Liver Transplantation

643. Is the Mayo Post-operative Mortality Risk Prediction Model Applicable to Asian Cirrhotic Patients?

H. . Yim; S. Park; J. Kim; Y. Jung; J. Kim; Y. Seo; J. Yeon; S. Um; K. Byun

 

Background and Aim:

Patients with liver cirrhosis are considered to be at increased risk of mortality and morbidity after surgery. Several factors associated with postoperative mortality have been identified, including increasing scores of Child-Pugh-Turcotte, model for end stage liver disease (MELD), and American Society of Anesthesiologists (ASA) class, but it is still difficult to predict postoperative outcomes in individual patient accurately. Most recently, a new model for the prediction of postoperative mortality risk in patients with cirrhosis was developed by Mayo clinic. The prediction model, which adopts variables such as ASA, MELD, and age, was based on mortality rate of cirrhotic patients who had undergone surgery under general anesthesia from a single hospital. Therefore it is unclear if the model could be applied to the cirrhotic patients at other centers, especially in Eastern countries which may have different etiology and prognosis of liver cirrhosis. To validate the usefulness of this model in Asian cirrhotic patients, we performed the present study.

 

Methods:

One hundred nine medical records from the patients who underwent surgery under general anesthesia at Korea University Ansan Hospital between January 1996 and December 2006 were retrospectively reviewed. Seventy three patients whose survival has been verified were included in this analysis.

 

Results:

A total of 17 patients (23.3%) died after surgery. MELD, ASA, and emergency surgery were proved to be independent risk factors for mortality by univariate analysis, but only ASA remained to be a risk factor by multivariable proportional hazards model. The areas under the receiver operating curve (AUC) of the prediction model were 0.988, 0.921, and 0.871 for 30 days, 90 days, and 1 year mortality, respectively. However, actual mortality were 5.4%, 10.9%, and 15.1% at 30 days, 90 days, and 1 year, respectively, which are lower than the predictive values of 7.2±5.9%, 11.2±8.2%, 22.6±8.5%. The difference between actual and predictive mortality rate at 1 year was significantly different (p<0.001)

 

Conclusions:

The risk prediction model, which was developed by Mayo clinic is also considered to a useful model in Asian cirrhotic patients. However, the model tends to overestimate the mortality, especially at the time of 1 year after surgery.